Call: +7 771 977 66 65, +7 705 421 2277
Sign in or Register
My basket

Astana Biomed Group, an authorized Abcam distributor in Central Asia

Abiomed homepage

  • Categories
    Signal Transduction
    Cancer
    Epigenetics and Nuclear Signaling
    Immunology
    Cell Biology
    Cardiovascular
    Neuroscience
    Tags & Cell Markers
    Kits/ Lysates/ Other
    Developmental Biology
    Microbiology
    Biochemicals
    Secondary antibodies
    Isotype/Loading Controls
    Antibody Arrays
  • About us
  • Partners
  • Contact
    Address

    Saryarka 32, 18, 010000, Astana city, Kazakhstan

    Telephone +7 771 977 66 65, +7 705 421 2277

    Email

    laboratory@ctlab.kz, orders@abiomed.kz

Back to category

Negative control siRNA vector (pGB control) (ab12505)

Negative control siRNA vector (pGB control) (ab12505)
  • ChIP - Anti-Histone H3 antibody - Nuclear Loading Control and ChIP Grade (ab1791)
  • ChIP - Anti-Histone H3 antibody - Nuclear Loading Control and ChIP Grade (ab1791)
  • ChIP - Anti-Histone H3 antibody - Nuclear Loading Control and ChIP Grade (ab1791)
  • ChIP - Anti-Histone H3 antibody - Nuclear Loading Control and ChIP Grade (ab1791)

You may also be interested in

Product image
Anti-Mus81 antibody [MTA30 2G10/3] (ab14387)
Product image
Mucicarmine Stain Kit (Mucin Stain) (ab150677)
Product image
Mouse MASPIN Antibody Pair - BSA and Azide free (ab244162)
Product image
Anti-Acyl-coenzyme A Thioesterase 4 antibody (ab121116)

Overview

  • Product name

    Negative control siRNA vector (pGB control)
    See all siRNA Vector vectors
  • General notes

    pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. The pGB Negative Control vector contains a insert that does not have significant homology to mammalian genes expressed in human, mouse, and rat, and it can be used as a negative control for pGB-Caspase siRNA vectors.


    This siRNA negative control vector is used as a negative control for siRNA expression. The pGB siRNA vectors can be transfected into mammalian cells using Lipofectamine (Invitrogen). For transient transfection, cells can be analyzed in 24-96 hours following transfections, by Western blot analysis or other detection means. For stable transfections, cells can be selected in G418 selection medium to obtain stable cell lines with the specific gene blocked.

Properties

  • Form

    Liquid
  • Storage instructions

    Shipped at 4°C. Store at +4°C short term (1-2 weeks). Upon delivery aliquot. Store at -20°C or -80°C. Avoid freeze / thaw cycle. Please see notes section.
  • Concentration information loading...
  • Research areas

    • Epigenetics and Nuclear Signaling
    • RNAi
    • RNAi vectors
  • Relevance

    Small interfering RNAs (siRNAs) are short, double-stranded RNA molecules that can target and degrade specific complementary mRNAs. The target gene-specific degradation is an effective means of gene suppression. Abcam's pGB siRNA vectors are designed to provide efficient, long-term suppression of a target gene in cultured mammalian cells and in vivo. The pGB vectors have been optimized for suppressing expression of target genes in mammalian cells by using the human U6 promotor (a RNA polymerase III promotor) which generates large amounts of siRNA in mammalian cells. The pGB expression vector also provides neomycin resistance marker for the selection of stable cell lines, permitting long-term suppression of the target gene. Validation: The antibodies listed as related products have not been previously used by Abcam to validate this vector. The siRNA vectors have been tested in HeLa and/or 293 cell lines. The siRNA-mediated knockdown was analyzed by Western blot.
  • Alternative names

    • siRNA vector
    • Small interfering ribose nucleic acid vector
    • Small interfering RNA vector

Images

  • Enzyme activity assay - Negative control siRNA vector (pGB control) (ab12505)
    Enzyme activity assay - Negative control siRNA vector (pGB control) (ab12505)

    RNA Interference Mechanism

    Once processed, the vector expressed siRNA is incorporated into a multi-protein nuclease complex known as the RNA-induced silencing complex (RISC). Homology between the sense portion of the siRNA sequence and the mRNA enables the nuclease enzyme to bind and cleave the caspase transcript into small pieces, which are degraded by the cell's machinery.

  • Vector - Negative control siRNA vector (pGB control) (ab12505)
    Vector - Negative control siRNA vector (pGB control) (ab12505)

    pGB vector

    Features and Positions:

    Human U6 Promoter: 1-256
    Multiple cloning Site: 259-285
    3' Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG)
    SV40 Promoter: 470-808
    Neomycin / Kanamycin Resistance ORF: 843-1634
    5' Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG)
    pUC Origin of Replication: 2222-3003

  • Other
    Other

    RNA Interference Mechanism

    Once processed, the vector expressed siRNA is incorporated into a multi-protein nuclease complex known as the RNA-induced silencing complex (RISC). Homology between the sense portion of the siRNA sequence and the mRNA enables the nuclease enzyme to bind and cleave the caspase transcript into small pieces, which are degraded by the cell's machinery.

  • Other
    Other

    pGB vector

    Features and Positions:

    Human U6 Promoter: 1-256
    Multiple cloning Site: 259-285
    3' Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG)
    SV40 Promoter: 470-808
    Neomycin / Kanamycin Resistance ORF: 843-1634
    5' Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG)
    pUC Origin of Replication: 2222-3003

Please note: All products are "FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES"
For licensing inquiries, please contact partnerships@abcam.com

Clear all

Recently viewed products

  •  
  • Product image

    Mouse COX2 ELISA Kit (ab210574)

  •  
  • Product image

    Recombinant human Tec protein (ab105197)

  •  
  • Product image

    Recombinant mouse CD47 protein (Active) (ab231160)

  •  
  • Product image

    Recombinant human ROR2 protein (ab70614)

  •  
  • Product image

    Recombinant Mouse CD28 protein (ab207143)

  •  
  • Product image

    Recombinant human IKK beta protein (Active) (ab217831)

Get resources and offers direct to your inbox Sign up
© 2021 Astana Biomed Group LLP. All rights reserved.