Call: +7 771 977 66 65, +7 705 421 2277
Sign in or Register
My basket

Astana Biomed Group, an authorized Abcam distributor in Central Asia

Abiomed homepage

  • Categories
    Signal Transduction
    Cancer
    Epigenetics and Nuclear Signaling
    Immunology
    Cell Biology
    Cardiovascular
    Neuroscience
    Tags & Cell Markers
    Kits/ Lysates/ Other
    Developmental Biology
    Microbiology
    Biochemicals
    Secondary antibodies
    Isotype/Loading Controls
    Antibody Arrays
  • About us
  • Partners
  • Contact
    Address

    Saryarka 32, 18, 010000, Astana city, Kazakhstan

    Telephone +7 771 977 66 65, +7 705 421 2277

    Email

    laboratory@ctlab.kz, orders@abiomed.kz

Back to category
Epigenetics and Nuclear Signaling Chromatin Binding Proteins Methylated DNA

Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] - ChIP Grade (ab106918)

Price and availability

278 083 ₸

Availability

Order now and get it on Wednesday March 10, 2021

Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] - ChIP Grade (ab106918)
  • ChIP - Anti-Histone H3 antibody - Nuclear Loading Control and ChIP Grade (ab1791)
  • ChIP - Anti-Histone H3 antibody - Nuclear Loading Control and ChIP Grade (ab1791)
  • ChIP - Anti-Histone H3 antibody - Nuclear Loading Control and ChIP Grade (ab1791)
  • ChIP - Anti-Histone H3 antibody - Nuclear Loading Control and ChIP Grade (ab1791)

Key features and details

  • Rat monoclonal [AB3/63.3] to 5-hydroxymethylcytosine (5-hmC) - ChIP Grade
  • Suitable for: ICC/IF, IP, ChIP, IHC-Fr, Dot blot, MeDIP
  • Reacts with: Species independent
  • Isotype: IgG2a

You may also be interested in

Product image
Anti-KAP1 antibody [EPR5216] - BSA and Azide free (ab215548)
Product image
Recombinant Human METTL7A protein (ab161809)
Product image
Anti-Pdd1 antibody (ab5338)
Product image
Anti-CBX4 antibody (ab114038)

Overview

  • Product name

    Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] - ChIP Grade
    See all 5-hydroxymethylcytosine (5-hmC) primary antibodies
  • Description

    Rat monoclonal [AB3/63.3] to 5-hydroxymethylcytosine (5-hmC) - ChIP Grade
  • Host species

    Rat
  • Tested applications

    Suitable for: ICC/IF, IP, ChIP, IHC-Fr, Dot blot, MeDIPmore details
  • Species reactivity

    Reacts with: Species independent
  • Immunogen

    5-hydroxymethylcytidine conjugated to KLH

  • General notes

    The Life Science industry has been in the grips of a reproducibility crisis for a number of years. Abcam is leading the way in addressing the problem with our range of recombinant monoclonal antibodies and knockout edited cell lines for gold-standard validation.

    One factor contributing to the crisis is the use of antibodies that are not suitable. This can lead to misleading results and the use of incorrect data informing project assumptions and direction. To help address this challenge, we have introduced an application and species grid on our primary antibody datasheets to make it easy to simplify identification of the right antibody for your needs.

    Learn more here.

Properties

  • Form

    Liquid
  • Storage instructions

    Shipped at 4°C. Store at +4°C short term (1-2 weeks). Upon delivery aliquot. Store at -20°C. Avoid freeze / thaw cycle.
  • Storage buffer

    pH: 7.40
    Preservative: 0.05% Sodium azide
    Constituent: PBS
  • Concentration information loading...
  • Purity

    Protein G purified
  • Clonality

    Monoclonal
  • Clone number

    AB3/63.3
  • Isotype

    IgG2a
  • Research areas

    • Epigenetics and Nuclear Signaling
    • DNA methylation
    • Methylated DNA
    • Epigenetics and Nuclear Signaling
    • DNA / RNA
    • Translation
    • Regulation
    • Epigenetics and Nuclear Signaling
    • DNA / RNA
    • DNA / Nucleotides
    • Cell Biology
    • Other Antibodies
    • Other Antibodies
    • Epigenetics and Nuclear Signaling
    • ChIP assays
    • ChIP antibodies

Images

  • Dot Blot - Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] - ChIP Grade (ab106918)
    Dot Blot - Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] - ChIP Grade (ab106918)
    Dot blot assay shows that ab106918 specifically recognized 5-hydroxymethyl Cytidine (hmC). Indicated amounts of hmC, methyl Cytidine (mC) and Cytidine (C) were spotted onto a membrane that was then incubated with ab106918. hmC, mC and C were generated in the following way: M13mp18 DNA had been amplified using primers F and R; F: atttccatgagcgtttttcc R: gcaaggcaaagaattagcaa. A 200 uM dNTP end concentration was used with 1. A,G,C,T and 2. A,G,hmC,T; where C had been replaced with HmdCTP. DNA was in vitro methylated with SssI and SAM, and 2ul of pmol of each base was denatured at 95C for 5 min and spotted and dried onto the membrane. The dot blot membrane was blocked with 10%skimmed milk + 1%BSA blocking overnight and then incubated with ab106918 at 1:500 in blocking solution. A goat anti rat HRP secondary antibody was used for ECL detection. This image is from an anonymous collaborator.
  • Dot Blot - Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] - ChIP Grade (ab106918)
    Dot Blot - Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] - ChIP Grade (ab106918)
    Dot blot competition assay in which ab106918 was preincubated with 5-hydroxymethyl Cytidine (5hmC) at amounts indicated in figure. Specified amounts of 5hmC, methyl Cytidine (mC) and Cytidine (C) were spotted onto membranes and were then incubated with ab106918 that had been preincubated with 5hmC as shown in figure. ab106918 specifically recognized 5hmC and this was blocked by preincubation with 5hmC at 5 pmol/ug ab106918 (Ab). This image is from an anonymous collaborator.
  • MeDIP - Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] - ChIP Grade (ab106918)
    MeDIP - Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] - ChIP Grade (ab106918)
    The specificity of ab106918 was confirmed by (h)MeDIP using qPCR validation of regions in ES cells that are highly enriched in 5-hydroxymethyl Cytidine (5hmC) (Pic1, Pic3 and Pic7) or not (Pic5 and Pic10). This image is from an anonymous collaborator.
  • ChIP - Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] - ChIP Grade (ab106918)
    ChIP - Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] - ChIP Grade (ab106918) This image is courtesy of an anonymous Abreview
    ChIP analysis of mouse ES nuclear cell lysate using ab106918 to bind 5-hydroxymethyl Cytidine. Chromatin was obtained by incubating with primary antibody (0.5 µg/µg chromatin in a glycerol IP buffer) for 16 hours at 4°C. Protein binding was detected using real-time PCR.

    See Abreview

Please note: All products are "FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES"
For licensing inquiries, please contact partnerships@abcam.com

Alternative products to Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] - ChIP Grade (ab106918)

  •  
  • Product image

    Anti-5-hydroxymethylcytosine (5-hmC) antibody [RM236] (ab214728)

    Applications: Dot, ELISA, Flow Cyt, ICC, IHC-P, MeDIP

  •  
  • Product image

    Anti-5-hydroxymethylcytosine (5-hmC) antibody (ab231902)

    Applications: Dot, IP

Clear all

Recently viewed products

  •  
  • Product image

    Anti-G3BP antibody [EPR13986(B)] - BSA and Azide free (ab240247)

  •  
  • Product image

    Anti-FGFR3 (phospho Y724) antibody [EPR2281(3)] - Low endotoxin, Azide free (ab215385)

Get resources and offers direct to your inbox Sign up
© 2021 Astana Biomed Group LLP. All rights reserved.