siRNA cloning vector (pGB) (ab12506)
Overview
-
Product name
siRNA cloning vector (pGB)
See all siRNA Vector vectors -
General notes
pGB expression vectors contain the human U6 RNA polymerase III promoter, which directs constitutive, high-level expression of short RNA transcripts in many cells. Each vector also contains the neomycin/kanamycin-resistance gene to provide kanamycin resistance in bacteria and the G418 resistance in mammalian cells. This pGB vector is used to clone your own insert. The vector contains two unique restriction sites, BamH I and Xba I for directional cloning.
Properties
-
Form
Liquid -
Storage instructions
Store at +4°C short term (1-2 weeks). Aliquot and store at -20°C or -80°C. Avoid repeated freeze / thaw cycles. -
Concentration information loading...
-
Research areas
-
Relevance
Small interfering RNAs (siRNAs) are short, double-stranded RNA molecules that can target and degrade specific complementary mRNAs. The target gene-specific degradation is an effective means of gene suppression. Abcam's pGB siRNA vectors are designed to provide efficient, long-term suppression of a target gene in cultured mammalian cells and in vivo. The pGB vectors have been optimized for suppressing expression of target genes in mammalian cells by using the human U6 promotor (a RNA polymerase III promotor) which generates large amounts of siRNA in mammalian cells. The pGB expression vector also provides neomycin resistance marker for the selection of stable cell lines, permitting long-term suppression of the target gene. Validation: The antibodies listed as related products have not been previously used by Abcam to validate this vector. The siRNA vectors have been tested in HeLa and/or 293 cell lines. The siRNA-mediated knockdown was analyzed by Western blot. -
Alternative names
- siRNA vector
- Small interfering ribose nucleic acid vector
- Small interfering RNA vector
Images
-
RNA Interference Mechanism
Once processed, the vector expressed siRNA is incorporated into a multi-protein nuclease complex known as the RNA-induced silencing complex (RISC). Homology between the sense portion of the siRNA sequence and the mRNA enables the nuclease enzyme to bind and cleave the caspase transcript into small pieces, which are degraded by the cell's machinery.
-
pGB vector
Features and Positions:
Human U6 Promoter: 1-256
Multiple cloning Site: 259-285
3' Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG)
SV40 Promoter: 470-808
Neomycin / Kanamycin Resistance ORF: 843-1634
5' Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG)
pUC Origin of Replication: 2222-3003 -
RNA Interference Mechanism
Once processed, the vector expressed siRNA is incorporated into a multi-protein nuclease complex known as the RNA-induced silencing complex (RISC). Homology between the sense portion of the siRNA sequence and the mRNA enables the nuclease enzyme to bind and cleave the caspase transcript into small pieces, which are degraded by the cell's machinery.
-
pGB vector
Features and Positions:
Human U6 Promoter: 1-256
Multiple cloning Site: 259-285
3' Primer: 398-426 (GAAGCATTTATCAGGGTTATTGTCTCATG)
SV40 Promoter: 470-808
Neomycin / Kanamycin Resistance ORF: 843-1634
5' Primer: 2789-2813 (CGTCGATTTTTGTGATGCTCGTCAG)
pUC Origin of Replication: 2222-3003