Call: +7 771 977 66 65, +7 705 421 2277
Sign in or Register
My basket

Astana Biomed Group, an authorized Abcam distributor in Central Asia

Abiomed homepage

  • Categories
    Signal Transduction
    Cancer
    Epigenetics and Nuclear Signaling
    Immunology
    Cell Biology
    Cardiovascular
    Neuroscience
    Tags & Cell Markers
    Kits/ Lysates/ Other
    Developmental Biology
    Microbiology
    Biochemicals
    Secondary antibodies
    Isotype/Loading Controls
    Antibody Arrays
  • About us
  • Partners
  • Contact
    Address

    Saryarka 32, 18, 010000, Astana city, Kazakhstan

    Telephone +7 771 977 66 65, +7 705 421 2277

    Email

    laboratory@ctlab.kz, orders@abiomed.kz

Back to category
Epigenetics and Nuclear Signaling Transcription Other factors

Nrf2 Transcription Factor Assay Kit (Colorimetric) (ab207223)

Price and availability

603 072 ₸

Availability

Order now and get it on Thursday February 25, 2021

Nrf2 Transcription Factor Assay Kit (Colorimetric) (ab207223)
  • ChIP - Anti-Histone H3 antibody - Nuclear Loading Control and ChIP Grade (ab1791)

Key features and details

  • Assay type: Semi-quantitative
  • Detection method: Colorimetric
  • Platform: Microplate reader
  • Assay time: 3 hr 30 min
  • Sample type: Nuclear Extracts
  • Sensitivity: 600 ng/well

You may also be interested in

Product image
Anti-KLF4 antibody (ab272860)
Product image
Anti-BRF2 antibody (ab17011)
Product image
Anti-HNF-1B antibody [EPR18644-37] (ab213150)
Product image
Alexa Fluor® 647 Anti-RUNX2 antibody [EPR14334] (ab215955)

Overview

  • Product name

    Nrf2 Transcription Factor Assay Kit (Colorimetric)
    See all Nrf2 kits
  • Detection method

    Colorimetric
  • Sample type

    Nuclear Extracts
  • Assay type

    Semi-quantitative
  • Sensitivity

    > 600 ng/well
  • Assay time

    3h 30m
  • Species reactivity

    Reacts with: Mouse, Rat, Human
  • Product overview

    Nrf2 Transcription Factor Assay Kit (Colorimetric) (ab207223) is a high throughput assay to quantify Nrf2 activation in nuclear extracts. This assay combines a quick ELISA format with a sensitive and specific non-radioactive assay for transcription factor activation.


    A specific double stranded DNA sequence containing the Nrf2 consensus binding site (5’ – GTCACAGTGACTCAGCAGAATCTG – 3’) has been immobilized onto a 96-well plate. Active Nrf2 present in the nuclear extract specifically binds to the oligonucleotide. Nrf2 is detected by a primary antibody that recognizes an epitope of Nrf2 accessible only when the protein is activated and bound to its target DNA. An HRP-conjugated secondary antibody provides sensitive colorimetric readout at OD 450 nm. This product detects only human, mouse and rat Nrf2.


    Key performance and benefits:


    Assay time: 3.5 hours (cell extracts preparation not included).


    Detection limit:

    Detection range: 0.6 – 10 µg nuclear extract/well.

  • Notes

    Nrf2 (NF-E2 related factor, NFE2L2, from nuclear factor erythroid-derived 2-like 2) is a basic leucine zipper (bZIP) transcription factor. Nrf2 binds to the antioxidant response element (ARE) and positively regulates the expression of detoxifying enzyme genes (such as NAD(P)H:quinone oxidoreductase1, NQO1) in response to antioxidants and xenobiotics. Higher levels of NQO1 gene expression has been shown in liver, lung, colon, and breast tumors.

    A cytosolic inhibitor of Nrf2, Keap1/INrf2, retains Nrf2 in the cytoplasm under normal conditions where the interaction of Nrf2 with INrf2 targets Nrf2 for ubiquitination and proteasomal degradation. However, after oxidative stress, Nrf2 is released from INrf2, translocates to the nucleus, and results in the activation of ARE-mediated gene expression. Nrf2 is also synthesized de novo after exposure to stress. In addition, Nrf2 controls its own degradation by regulating expression and induction of INrf2.

    It has been shown that nuclear export and degradation pathways are activated by around two hours after treatment with tert-butylhydroquinone (t-BHQ).

    Nrf2 activation and degradation are important sensing mechanisms in the cellular response for oxidative and electrophilic stressors.

  • Platform

    Microplate reader

Properties

  • Storage instructions

    Please refer to protocols.
  • Components 1 x 96 tests 5 x 96 tests
    10X Antibody Binding Buffer 1 x 2.2ml 1 x 11ml
    10X Wash Buffer 1 x 22ml 1 x 110ml
    96-well Nrf2 assay plate 1 unit 5 units
    Anti-rabbit HRP-conjugated IgG (0.25 μg/μL) 1 x 10µl 1 x 55µl
    Binding Buffer 1 x 10ml 1 x 50ml
    Developing Solution 1 x 11ml 1 x 55ml
    Dithiothreitol (DTT) (1 M) 1 x 100µl 1 x 500µl
    Herring sperm DNA (1 μg/μL) 1 x 100µl 1 x 500µl
    Lysis Buffer 1 x 10ml 1 x 50ml
    Mutated oligonucleotide (10 pmol/µL) 1 x 100µl 1 x 500µl
    Nrf2 antibody 1 x 10µl 1 x 25µl
    Plate sealer 1 unit 5 units
    Positive control extract (2.5 µg/µL) 1 x 20µl 1 x 50µl
    Protease Inhibitor Cocktail 1 x 100µl 1 x 500µl
    Stop Solution 1 x 11ml 1 x 55ml
    Wild-type oligonucleotide (10 pmol/µL) 1 x 100µl 1 x 500µl
  • Research areas

    • Epigenetics and Nuclear Signaling
    • Transcription
    • Other factors
    • Cell Biology
    • Other Antibodies
    • Oxidative Stress
    • Cardiovascular
    • Heart
    • Cardiac metabolism
    • Metabolism
    • Pathways and Processes
    • Mitochondrial Metabolism
    • Mitochondrial Biogenesis
    • Metabolism
    • Pathways and Processes
    • Metabolic signaling pathways
    • Nucleotide metabolism
    • Molecular processes
    • Mitochondrial transcription
    • Metabolism
    • Pathways and Processes
    • Redox metabolism
    • Oxidative stress
  • Function

    Transcription activator that binds to antioxidant response (ARE) elements in the promoter regions of target genes. Important for the coordinated up-regulation of genes in response to oxidative stress. May be involved in the transcriptional activation of genes of the beta-globin cluster by mediating enhancer activity of hypersensitive site 2 of the beta-globin locus control region.
  • Tissue specificity

    Widely expressed. Highest expression in adult muscle, kidney, lung, liver and in fetal muscle.
  • Sequence similarities

    Belongs to the bZIP family. CNC subfamily.
    Contains 1 bZIP domain.
  • Domain

    Acidic activation domain in the N-terminus, and DNA binding domain in the C-terminus.
  • Post-translational
    modifications

    Phosphorylation of Ser-40 by PKC in response to oxidative stress dissociates NFE2L2 from its cytoplasmic inhibitor KEAP1, promoting its translocation into the nucleus.
  • Cellular localization

    Cytoplasm > cytosol. Nucleus. Cytosolic under unstressed conditions, translocates into the nucleus upon induction by electrophilic agents.
  • Target information above from: UniProt accession Q16236 The UniProt Consortium
    The Universal Protein Resource (UniProt) in 2010
    Nucleic Acids Res. 38:D142-D148 (2010) .

    Information by UniProt
  • Alternative names

    • erythroid derived 2
    • HEBP1
    • like 2
    • NF E2 related factor 2
    • NF-E2-related factor 2
    • NF2L2_HUMAN
    • NFE2 related factor 2
    • NFE2-related factor 2
    • Nfe2l2
    • Nrf 2
    • NRF2
    • Nuclear factor
    • Nuclear factor (erythroid derived 2) like 2
    • nuclear factor erythroid 2 like 2
    • Nuclear factor erythroid 2 related factor 2
    • Nuclear factor erythroid 2-related factor 2
    • Nuclear factor erythroid derived 2 like 2
    see all
  • Database links

    • Entrez Gene: 4780 Human
    • Entrez Gene: 18024 Mouse
    • Entrez Gene: 83619 Rat
    • Omim: 600492 Human
    • SwissProt: Q16236 Human
    • SwissProt: Q60795 Mouse
    • SwissProt: O54968 Rat
    • Unigene: 744006 Human
    • Unigene: 1025 Mouse
    • Unigene: 10867 Rat
    see all

Images

  • Nuclear extracts from untreated HepG2 cells (Light gray) and HepG2 cells treated with D,L Sulforaphane (Black) were assayed from 0.625 to 10 µg/well for Nrf2 activation using ab207223.
    Nuclear extracts from untreated HepG2 cells (Light gray) and HepG2 cells treated with D,L Sulforaphane (Black) were assayed from 0.625 to 10 µg/well for Nrf2 activation using ab207223.

    Different amounts of nuclear extracts from untreated HepG2 cells (light grey) and HepG2 cells treated with D,L-Sulforaphane (Black) were tested for Nrf2 activation.  These results are provided for demonstration only.

Please note: All products are "FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES"
For licensing inquiries, please contact partnerships@abcam.com

Clear all

Recently viewed products

  •  
  • Product image

    Human EMMPRIN ELISA Kit (ab219631)

  •  
  • Product image

    Anti-TFPI antibody (ab181392)

  •  
  • Recombinant Human Interferon alpha 1 protein (ab192277)

Get resources and offers direct to your inbox Sign up
© 2021 Astana Biomed Group LLP. All rights reserved.